Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative IHC images of CBX2 staining (nuclear, brown) from the high ( N = 67) and the low ( N = 56) CBX2 groups of EOC patients with a median score of 6 as the cut-off value. Scale bar, 50 μm. b Kaplan-Meier plots showing the progression-free survival of 123 EOC and 101 HGSOC patients with tumors expressing high and low levels of CBX2 along with hazard ratios and P values (high vs. low, cox regression. c Violin plots presenting the IHC scores of CBX2 in platinum-resistant and -sensitive EOC and HGSOC patients (Mann-Whitney test). d Cell viability in the CBX2 knockdown cells compared with controls after gradient concentrations of cDDP treatment for 72 h detected by MTT assay. e Representative images and ( f ) quantification of colony formation assays for CRISPR-Cas9 CBX2 knockout OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). g Quantification of colony formation assay for CBX2 over-expressed OVCAR4 and CAOV3 cells compared with controls after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). h Images of subcutaneous xenografts derived from CBX2-knockout and control CAOV3 cells treated with saline and cDDP ( N = 3). i Quantification of tumor volume and weight of the CBX2-knockout (CBX2 KO ) compared with the control groups (CBX2 NC ) upon treatment of cDDP (3 mg/kg, every other day) and saline on the day of sacrifice. j Quantification of IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Staining, Expressing, MANN-WHITNEY, Knockdown, MTT Assay, CRISPR, Knock-Out, Two Tailed Test, Colony Assay, Derivative Assay, Control, Saline

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative images of the karyotype of CBX2 knockout (CBX2 KO ) and control (CBX2 NC ) cells. b Quantification of chromosomal breaks in CBX2 KO and CBX2 NC cells at metaphase (unpaired two-tailed Student’s t test). c Representative images and quantification ( d ) of γH2AX foci and ( e ) micronuclei staining performed in the CBX2 KO and the control OVCAR4 cells. Scale bar, 20 μm (unpaired two-tailed Student’s t test). f Representative images and ( g ) quantification of the tail moment of the neutral comet assay of the CBX2 KO and the control OVCAR4 cells treated with 15 μM cDDP or saline for 72 h (unpaired two-tailed Student’s t test). h Reactome GSEA enrichment score curves of chromatin-bound proteomics from the CBX2 KO OVRCAR4 cells compared to the control cells. i Volcano plots presenting up-regulated apoptosis-associated proteins and down-regulated DNA damage checkpoints in the CBX2 KO compared to the control OVCAR4 cells. j Schematic illustration of the HR/NHEJ reporter assay. k Quantification of the percentage of GFP/mCherry positive cells in the CBX2 KO and the control OVCAR4 cells through flow cytometry (one-way ANOVA). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Knock-Out, Control, Two Tailed Test, Staining, Neutral Comet Assay, Saline, Reporter Assay, Flow Cytometry

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative confocal images of FRAP of EGFP signal in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut transfected CBX2 knock-out OVCAR4 cells (OVCAR4-CBX2 KO ) at pre-breaching (0 seconds), breaching (2 seconds), and post-breaching (122 seconds). Scale bar, 5 μm. b FRAP curves of EGFP signal in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT cells. c Percentage of mobility of CBX2 in CBX2-IDR Mut and CBX2-IDR WT cells. d Quantification of γH2AX foci and ( e ) micronuclei staining performed in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells. Scale bar, 20 μm (unpaired two-tailed Student’s t test). f Quantification of chromosomal breaks in EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells treated with cDDP at metaphase (one-way ANOVA). g Quantification of the tail moment of the neutral comet assay of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells treated with 15 μM cDDP or saline for 72 h (unpaired two-tailed Student’s t test). h Cell viability in the EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells after gradient concentrations of cDDP treatment for 72 h detected by MTT assay. i Quantification of colony formation assay for EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells after indicated cDDP treatment for 14 days (unpaired two-tailed Student’s t test). j Quantification of the percentage of GFP/mCherry positive cells in the EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut cells through flow cytometry (one-way ANOVA). k Tumor volume and ( l ) tumor weight of subcutaneous xenografts derived from EGFP-tagged CBX2-IDR WT and EGFP-CBX2-IDR Mut cells treated with saline, cDDP, oil and Niraparib. ( m ) and ( n ) IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts treated with saline, cDDP, oil and Niraparib. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Transfection, Knock-Out, Staining, Two Tailed Test, Neutral Comet Assay, Saline, MTT Assay, Colony Assay, Flow Cytometry, Derivative Assay

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a GSEA enrichment score curves of the gene expression alterations of EGFP-tagged CBX2-IDR Mut compared to CBX2-IDR WT cells upon treatment with 15 μM cDDP for 18 hours. ES, enrichment score; NES, normalized enrichment score; FDR, false discovery rate. b Bubble diagram showing changes between the chromatin-bound DDR-associated proteins among EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR4-CBX2 KO cells upon treatment with 15 μM cDDP for 18 hours through proteomic analysis. CNE, chromatin-bound nuclear extract. c Schematic diagram presenting chromatin-bound DSB repair proteins identified in ( b ). d Western blots of indicated DSB proteins in the CNE and WCL of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR4-CBX2 KO cells. CNE, chromatin-bound nuclear extract; WCL, whole-cell lysate. e Schematic diagram presenting candidate CBX2 binding proteins detected in EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut OVCAR4-CBX2 KO cells upon treatment with 15 μM cDDP for 18 hours through proteomic analysis. f Western blots of γH2AX, BRCA1, Rad51, PARP1, NUMA, H3K27me3, and CBX2 from lysate of input, CBX2-IP, and IgG derived from OVCAR4-CBX2 KO cells transfected with EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut upon treatment with 15 μM cDDP for 18 hours. CBX2-IP, lysate co-immunoprecipitated with CBX2.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Gene Expression, Western Blot, Binding Assay, Derivative Assay, Transfection, Immunoprecipitation

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a FRAP curves of EGFP signal in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells with mobile and dense CBX2 condensates treated with saline, cDDP, DMSO, Niraparib, and GSK126. b Representative images of CBX2 distribution pattern in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells treated with saline, cDDP, DMSO, Niraparib, and GSK126. Scale bar, 5 μm. c Quantification of the percentage of dense CBX2 condensates in cells with indicated compound treatment in live and ( d ) fixed cells. e Representative images of γH2AX, BRCA1, and 53BP1 foci in EGFP-tagged CBX2-IDR Mut and CBX2-IDR WT OVCAR4-CBX2 KO cells treated with saline, cDDP, DMSO, and Niraparib. Scale bar, 20 μm. Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Saline

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Schematic illustration of the compound library screening and the rank of the compound with a percent difference in area under curve values (%AUC Diff ) in EGFP-tagged CBX2-IDR WT cells compared to CBX2-IDR Mut cells, more than 20% in the initial screen. b Waterfall plots of all the drugs ranked in the initial screen and ( c ) the validation screen. d Cell viability of EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut OVCAR-CBX2 KO cells treated with gradient concentrations of Ibrutinib for 72 h evaluated by MTT assay. ( e ) Tumor volume and ( f ) tumor weight of subcutaneous xenografts derived from EGFP-tagged CBX2-IDR WT and CBX2-IDR Mut CAOV3-CBX2 KO cells treated with DMSO and Ibrutinib. g IHC scores of CBX2, Ki-67, H2AX, and cleaved-caspase3 of tumor tissues from subcutaneous xenografts. h Heatmap showing differential gene expression and ( i ) BTK-associated gene expression changes between the EGFP-tagged NC, CBX2-IDR WT , and CBX2-IDR Mut cells. j Quantification of the percentage of GFP/mCherry positive cells in parental OVCAR4 and CAOV3 cells transfected with the HR/NHEJ reporter system, exposed to the indicated concentrations of Ibrutinib by flow cytometry (one-way ANOVA). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Drug discovery, Biomarker Discovery, MTT Assay, Derivative Assay, Gene Expression, Transfection, Flow Cytometry

Journal: Cell Death & Disease

Article Title: CBX2 phase-separation contributes to homologous recombination repair and drug resistance in ovarian cancer

doi: 10.1038/s41419-026-08605-4

Figure Lengend Snippet: a Representative images of patients with non-condensate, condensate, and negative CBX2 patterns. Red, EpCAM; Green, CBX2; Blue, DAPI. Scale bar, 20 μm. b The Kaplan-Meier plot depicts the overall survival, and ( c ) progression-free survival of patients with all histologies and those with HGSOC presenting varying CBX2 positivity and patterns, and the corresponding hazard ratios (log-rank test, cox-regression). d Representative images of IHC staining of EpCAM, P53, PAX8, WT, and CBX2 of PDOs and their respective tissues of origin. Scale bar, 40 μm. e Representative images of PDOs derived from 8 patients before and after treatment with DMSO and Ibrutinib for 96 hours. Scale bar, 40 μm. f Viability of PDOs with high and low IHC score of CBX2 treated with DMSO and Ibrutinib for 96 h. PDO, patient-derived organoid (unpaired two-tailed Student’s t test). Data represent mean ± SEM of at least three independent biological replicates. ns not significant, * P < 0.05.

Article Snippet: The sgRNA sequences targeting CBX2 (Sg859 5’-3’ ACCAGCCGCGCCACTTGACC, Sg861 5’-3’ GAGCTTGGAGCGCCGGCTGC) were synthesized by GeneChem (Shanghai, China).

Techniques: Immunohistochemistry, Derivative Assay, Two Tailed Test